Review

rabbit anti fluc luciferase polyclonal antibody (Bioss)

Bioss is a verified supplier

Bioss manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Bioss rabbit anti fluc luciferase polyclonal antibody

Construction and transcriptional analysis of the PRRSV replicon. A , schematic diagram of reporter replicon genome structure, replication, and sg mRNA production. ORF2-6 in the wild-type viral genome were deleted and replaced with the <t>Fluc-T2A-RFP</t> gene cassette. B , gel electrophoresis, restriction enzyme digestion (NotI and AscI), and sequencing analysis of Rep-PRRSV and Rep-ΔORF1b replicon plasmids. C , replication kinetics of Rep-PRRSV. BHK-21 cells were co-transfected with pRL-TK (250 ng) and Rep-PRRSV (2.5 μg), harvested at different time points, and firefly <t>luciferase</t> activity was measured and normalized to Renilla luciferase reading. D , RT-qPCR analysis of sg mRNA levels for Fluc, N, and ORF1ab in BHK-21 cells transfected with Rep-PRRSV, normalized to β-actin gene expression. E , Rep-PRRSV-transfected BHK-21 cells were analyzed at 36 h post-transfection (hpt) by confocal microscopy. Fluc was detected using an anti-Fluc mAb and goat-anti-mouse IgG conjugated with Alexa Fluor 488. Nuclei were stained with Hoechst. F , electron microscopy analysis of double-membrane vesicle structures induced by Rep-PRRSV transfection at 24 hpt. Two-way ANOVA was used to determine statistical significance. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Rabbit Anti Fluc Luciferase Polyclonal Antibody, supplied by Bioss, used in various techniques. Bioz Stars score: 94/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+anti+fluc+luciferase+polyclonal+antibody/pmc12180982-188-16-21?v=Bioss
Average 94 stars, based on 5 article reviews

rabbit anti fluc luciferase polyclonal antibody - by Bioz Stars, 2026-08

94/100 stars

Images

1) Product Images from "Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus"

Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

Journal: The Journal of Biological Chemistry

doi: 10.1016/j.jbc.2025.110247

Figure Legend Snippet: Construction and transcriptional analysis of the PRRSV replicon. A , schematic diagram of reporter replicon genome structure, replication, and sg mRNA production. ORF2-6 in the wild-type viral genome were deleted and replaced with the Fluc-T2A-RFP gene cassette. B , gel electrophoresis, restriction enzyme digestion (NotI and AscI), and sequencing analysis of Rep-PRRSV and Rep-ΔORF1b replicon plasmids. C , replication kinetics of Rep-PRRSV. BHK-21 cells were co-transfected with pRL-TK (250 ng) and Rep-PRRSV (2.5 μg), harvested at different time points, and firefly luciferase activity was measured and normalized to Renilla luciferase reading. D , RT-qPCR analysis of sg mRNA levels for Fluc, N, and ORF1ab in BHK-21 cells transfected with Rep-PRRSV, normalized to β-actin gene expression. E , Rep-PRRSV-transfected BHK-21 cells were analyzed at 36 h post-transfection (hpt) by confocal microscopy. Fluc was detected using an anti-Fluc mAb and goat-anti-mouse IgG conjugated with Alexa Fluor 488. Nuclei were stained with Hoechst. F , electron microscopy analysis of double-membrane vesicle structures induced by Rep-PRRSV transfection at 24 hpt. Two-way ANOVA was used to determine statistical significance. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Techniques Used: Nucleic Acid Electrophoresis, Sequencing, Transfection, Luciferase, Activity Assay, Quantitative RT-PCR, Gene Expression, Confocal Microscopy, Staining, Electron Microscopy, Membrane

Evaluation of transcriptional regulatory efficiency of TRSs in Rep-PRRSV. A , replicon plasmids containing transcriptional units with different transcription-regulating sequences B (TRSB) (TRS2: ACCCTGTCATTGAACCAACTTTAG, TRS3: AGGGTCAAATGTAACCATAGTGTA, TRS4: AGCAATTGGTTTCACCTGGAATGG, TRS5: AGCAACCGTTTTAGCCTGTCTTTT, TRS6: AGCAACCCTTTAACCAGAGTTTC, TRS7.1: ACGGCAAATGATAACCACGCATTT, TRS7.2: AAGGGAGTGGTAAACCTTGTTAAA) inserted upstream of the Fluc-T2A-RFP reporter were constructed using the Rep-PRRSV backbone. B , Luciferase activity and ( C ) RFP fluorescence intensity was measured at 36 h post-transfection to assess TRS regulatory efficiency. One-way ANOVA was used to determine statistical significance. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Figure Legend Snippet: Evaluation of transcriptional regulatory efficiency of TRSs in Rep-PRRSV. A , replicon plasmids containing transcriptional units with different transcription-regulating sequences B (TRSB) (TRS2: ACCCTGTCATTGAACCAACTTTAG, TRS3: AGGGTCAAATGTAACCATAGTGTA, TRS4: AGCAATTGGTTTCACCTGGAATGG, TRS5: AGCAACCGTTTTAGCCTGTCTTTT, TRS6: AGCAACCCTTTAACCAGAGTTTC, TRS7.1: ACGGCAAATGATAACCACGCATTT, TRS7.2: AAGGGAGTGGTAAACCTTGTTAAA) inserted upstream of the Fluc-T2A-RFP reporter were constructed using the Rep-PRRSV backbone. B , Luciferase activity and ( C ) RFP fluorescence intensity was measured at 36 h post-transfection to assess TRS regulatory efficiency. One-way ANOVA was used to determine statistical significance. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Techniques Used: Construct, Luciferase, Activity Assay, Fluorescence, Transfection

Regulatory effects of PRRSV non-structural and structural proteins on replicon transcription. A , BHK-21 cells were co-transfected with Rep-PRRSV (1 μg) and plasmids expressing individual PRRSV nsps (0.5 μg), and Fluc activity was measured at 36 hpt to assess their effects on replicon transcription. B , PRRSV nsps protein expression was analyzed by Western blot 36 hpt. C and D , increasing concentrations of nsp9-HA and nsp12-HA plasmids were co-transfected with Rep-PRRSV into BHK-21 cells, and luciferase activity was measured at 36 hpt. E , effect of GP5, M, and N overexpression on Rep-PRRSV transcriptional activity. F , Analysis of nsp9 and nsp12 overexpression effects on rHP-PRRSV/SD16/TRS6-EGFP replication. MARC-145 cells were transfected with nsp9-HA or nsp12-HA plasmids for 24 h, followed by infection with rHP-PRRSV/SD16/TRS6-EGFP (MOI 0.1). Cells were harvested 24 h later, and viral replication was analyzed by Western blot. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant compared to the indicated control samples.

Figure Legend Snippet: Regulatory effects of PRRSV non-structural and structural proteins on replicon transcription. A , BHK-21 cells were co-transfected with Rep-PRRSV (1 μg) and plasmids expressing individual PRRSV nsps (0.5 μg), and Fluc activity was measured at 36 hpt to assess their effects on replicon transcription. B , PRRSV nsps protein expression was analyzed by Western blot 36 hpt. C and D , increasing concentrations of nsp9-HA and nsp12-HA plasmids were co-transfected with Rep-PRRSV into BHK-21 cells, and luciferase activity was measured at 36 hpt. E , effect of GP5, M, and N overexpression on Rep-PRRSV transcriptional activity. F , Analysis of nsp9 and nsp12 overexpression effects on rHP-PRRSV/SD16/TRS6-EGFP replication. MARC-145 cells were transfected with nsp9-HA or nsp12-HA plasmids for 24 h, followed by infection with rHP-PRRSV/SD16/TRS6-EGFP (MOI 0.1). Cells were harvested 24 h later, and viral replication was analyzed by Western blot. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant compared to the indicated control samples.

Techniques Used: Transfection, Expressing, Activity Assay, Western Blot, Luciferase, Over Expression, Infection, Control

Construction and characterization of subgenomic replicon sg-Rep-PRRSV. A , schematic diagram of the sg-Rep-PRRSV subgenomic replicon containing 5′ and 3′UTRs, leader TRS, Fluc reporter, and ORF7. B , construction and sequencing validation of sg-Rep-PRRSV and mini-RTC system plasmids. C , BHK-21 cells were co-transfected with the indicated plasmids, and Fluc activity and protein expression were analyzed by luciferase assay and Western blot at 36 h post-transfection (hpt). D , analysis of sg-Rep-PRRSV-Fluc expression under different ratios of nsp8-9, nsp10, nsp11, and nsp12. E , AlphaFold two was used to model the 3D structure of PRRSV nsp9, showing specific functional regions (NiRAN, fingers, palm, and thumb of RdRp) and the spatial positions of conserved motifs, as visualized using PyMOL. F , activity assessment of nsp9 conserved functional domain mutants using the sg-Rep-PRRSV system. Bars represent mean ± SD. ∗∗∗∗ p < 0.0001; ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Figure Legend Snippet: Construction and characterization of subgenomic replicon sg-Rep-PRRSV. A , schematic diagram of the sg-Rep-PRRSV subgenomic replicon containing 5′ and 3′UTRs, leader TRS, Fluc reporter, and ORF7. B , construction and sequencing validation of sg-Rep-PRRSV and mini-RTC system plasmids. C , BHK-21 cells were co-transfected with the indicated plasmids, and Fluc activity and protein expression were analyzed by luciferase assay and Western blot at 36 h post-transfection (hpt). D , analysis of sg-Rep-PRRSV-Fluc expression under different ratios of nsp8-9, nsp10, nsp11, and nsp12. E , AlphaFold two was used to model the 3D structure of PRRSV nsp9, showing specific functional regions (NiRAN, fingers, palm, and thumb of RdRp) and the spatial positions of conserved motifs, as visualized using PyMOL. F , activity assessment of nsp9 conserved functional domain mutants using the sg-Rep-PRRSV system. Bars represent mean ± SD. ∗∗∗∗ p < 0.0001; ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Techniques Used: Sequencing, Biomarker Discovery, Transfection, Activity Assay, Expressing, Luciferase, Western Blot, Functional Assay

Evaluation of the effect of GD- and XM-2020-derived mini-RTC components on sg-Rep-PRRSV(GD) transcription. A , sequence alignment and ( B ) predicted secondary structures of the 5′ and 3′UTRs from PRRSV GD and XM-2020. C , expression of nsps, ( D ) Fluc activity assay, and ( E ) percentage of Fluc-positive cells in BHK-21 cells co-transfected with sg-Rep-PRRSV and mini-RTC components derived from either GD or XM-2020 at 36 hpt. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Figure Legend Snippet: Evaluation of the effect of GD- and XM-2020-derived mini-RTC components on sg-Rep-PRRSV(GD) transcription. A , sequence alignment and ( B ) predicted secondary structures of the 5′ and 3′UTRs from PRRSV GD and XM-2020. C , expression of nsps, ( D ) Fluc activity assay, and ( E ) percentage of Fluc-positive cells in BHK-21 cells co-transfected with sg-Rep-PRRSV and mini-RTC components derived from either GD or XM-2020 at 36 hpt. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Techniques Used: Derivative Assay, Sequencing, Expressing, Activity Assay, Transfection

Effect of nsp9 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp9 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp9 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp8-9 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp9 mutants, and other mini-RTC components (nsp10–12), and Fluc activity was measured at 36 hpt. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Figure Legend Snippet: Effect of nsp9 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp9 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp9 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp8-9 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp9 mutants, and other mini-RTC components (nsp10–12), and Fluc activity was measured at 36 hpt. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Techniques Used: Sequencing, Expressing, Transfection, Activity Assay

Effect of nsp10 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp10 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp10 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp10 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp10 mutants, and other mini-RTC components, and Fluc activity was measured at 36 hpt. Data are presented as mean ± SD, representing three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Figure Legend Snippet: Effect of nsp10 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp10 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp10 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp10 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp10 mutants, and other mini-RTC components, and Fluc activity was measured at 36 hpt. Data are presented as mean ± SD, representing three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Techniques Used: Sequencing, Expressing, Transfection, Activity Assay

Effect of nsp12 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp12 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp12 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp12 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp12 mutants, and other mini-RTC components, and Fluc activity was measured at 36 hpt. Data are mean ± SD from at least three biological replicates. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Figure Legend Snippet: Effect of nsp12 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp12 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp12 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp12 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp12 mutants, and other mini-RTC components, and Fluc activity was measured at 36 hpt. Data are mean ± SD from at least three biological replicates. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Techniques Used: Sequencing, Expressing, Transfection, Activity Assay

Image Search Results

Journal: The Journal of Biological Chemistry

Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

doi: 10.1016/j.jbc.2025.110247

Figure Lengend Snippet: Construction and transcriptional analysis of the PRRSV replicon. A , schematic diagram of reporter replicon genome structure, replication, and sg mRNA production. ORF2-6 in the wild-type viral genome were deleted and replaced with the Fluc-T2A-RFP gene cassette. B , gel electrophoresis, restriction enzyme digestion (NotI and AscI), and sequencing analysis of Rep-PRRSV and Rep-ΔORF1b replicon plasmids. C , replication kinetics of Rep-PRRSV. BHK-21 cells were co-transfected with pRL-TK (250 ng) and Rep-PRRSV (2.5 μg), harvested at different time points, and firefly luciferase activity was measured and normalized to Renilla luciferase reading. D , RT-qPCR analysis of sg mRNA levels for Fluc, N, and ORF1ab in BHK-21 cells transfected with Rep-PRRSV, normalized to β-actin gene expression. E , Rep-PRRSV-transfected BHK-21 cells were analyzed at 36 h post-transfection (hpt) by confocal microscopy. Fluc was detected using an anti-Fluc mAb and goat-anti-mouse IgG conjugated with Alexa Fluor 488. Nuclei were stained with Hoechst. F , electron microscopy analysis of double-membrane vesicle structures induced by Rep-PRRSV transfection at 24 hpt. Two-way ANOVA was used to determine statistical significance. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Article Snippet: The primary antibodies used in this study were: rabbit anti-PRRSV-N polyclonal antibody (generated in our laboratory), rabbit anti-Fluc luciferase polyclonal antibody (BIOSS, bsm-33318M), mouse anti-β-Actin monoclonal antibody (Tianjin Sungene, DKM9001L), and mouse anti-GAPDH monoclonal antibody (Tianjin Sungene, DKM9002).

Techniques: Nucleic Acid Electrophoresis, Sequencing, Transfection, Luciferase, Activity Assay, Quantitative RT-PCR, Gene Expression, Confocal Microscopy, Staining, Electron Microscopy, Membrane

Journal: The Journal of Biological Chemistry

Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

doi: 10.1016/j.jbc.2025.110247

Figure Lengend Snippet: Evaluation of transcriptional regulatory efficiency of TRSs in Rep-PRRSV. A , replicon plasmids containing transcriptional units with different transcription-regulating sequences B (TRSB) (TRS2: ACCCTGTCATTGAACCAACTTTAG, TRS3: AGGGTCAAATGTAACCATAGTGTA, TRS4: AGCAATTGGTTTCACCTGGAATGG, TRS5: AGCAACCGTTTTAGCCTGTCTTTT, TRS6: AGCAACCCTTTAACCAGAGTTTC, TRS7.1: ACGGCAAATGATAACCACGCATTT, TRS7.2: AAGGGAGTGGTAAACCTTGTTAAA) inserted upstream of the Fluc-T2A-RFP reporter were constructed using the Rep-PRRSV backbone. B , Luciferase activity and ( C ) RFP fluorescence intensity was measured at 36 h post-transfection to assess TRS regulatory efficiency. One-way ANOVA was used to determine statistical significance. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Techniques: Construct, Luciferase, Activity Assay, Fluorescence, Transfection

Journal: The Journal of Biological Chemistry

Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

doi: 10.1016/j.jbc.2025.110247

Figure Lengend Snippet: Regulatory effects of PRRSV non-structural and structural proteins on replicon transcription. A , BHK-21 cells were co-transfected with Rep-PRRSV (1 μg) and plasmids expressing individual PRRSV nsps (0.5 μg), and Fluc activity was measured at 36 hpt to assess their effects on replicon transcription. B , PRRSV nsps protein expression was analyzed by Western blot 36 hpt. C and D , increasing concentrations of nsp9-HA and nsp12-HA plasmids were co-transfected with Rep-PRRSV into BHK-21 cells, and luciferase activity was measured at 36 hpt. E , effect of GP5, M, and N overexpression on Rep-PRRSV transcriptional activity. F , Analysis of nsp9 and nsp12 overexpression effects on rHP-PRRSV/SD16/TRS6-EGFP replication. MARC-145 cells were transfected with nsp9-HA or nsp12-HA plasmids for 24 h, followed by infection with rHP-PRRSV/SD16/TRS6-EGFP (MOI 0.1). Cells were harvested 24 h later, and viral replication was analyzed by Western blot. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant compared to the indicated control samples.

Techniques: Transfection, Expressing, Activity Assay, Western Blot, Luciferase, Over Expression, Infection, Control

Journal: The Journal of Biological Chemistry

Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

doi: 10.1016/j.jbc.2025.110247

Figure Lengend Snippet: Construction and characterization of subgenomic replicon sg-Rep-PRRSV. A , schematic diagram of the sg-Rep-PRRSV subgenomic replicon containing 5′ and 3′UTRs, leader TRS, Fluc reporter, and ORF7. B , construction and sequencing validation of sg-Rep-PRRSV and mini-RTC system plasmids. C , BHK-21 cells were co-transfected with the indicated plasmids, and Fluc activity and protein expression were analyzed by luciferase assay and Western blot at 36 h post-transfection (hpt). D , analysis of sg-Rep-PRRSV-Fluc expression under different ratios of nsp8-9, nsp10, nsp11, and nsp12. E , AlphaFold two was used to model the 3D structure of PRRSV nsp9, showing specific functional regions (NiRAN, fingers, palm, and thumb of RdRp) and the spatial positions of conserved motifs, as visualized using PyMOL. F , activity assessment of nsp9 conserved functional domain mutants using the sg-Rep-PRRSV system. Bars represent mean ± SD. ∗∗∗∗ p < 0.0001; ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Techniques: Sequencing, Biomarker Discovery, Transfection, Activity Assay, Expressing, Luciferase, Western Blot, Functional Assay

Journal: The Journal of Biological Chemistry

Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

doi: 10.1016/j.jbc.2025.110247

Figure Lengend Snippet: Evaluation of the effect of GD- and XM-2020-derived mini-RTC components on sg-Rep-PRRSV(GD) transcription. A , sequence alignment and ( B ) predicted secondary structures of the 5′ and 3′UTRs from PRRSV GD and XM-2020. C , expression of nsps, ( D ) Fluc activity assay, and ( E ) percentage of Fluc-positive cells in BHK-21 cells co-transfected with sg-Rep-PRRSV and mini-RTC components derived from either GD or XM-2020 at 36 hpt. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Techniques: Derivative Assay, Sequencing, Expressing, Activity Assay, Transfection

Journal: The Journal of Biological Chemistry

Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

doi: 10.1016/j.jbc.2025.110247

Figure Lengend Snippet: Effect of nsp9 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp9 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp9 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp8-9 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp9 mutants, and other mini-RTC components (nsp10–12), and Fluc activity was measured at 36 hpt. Data represent the mean ± SD of three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Techniques: Sequencing, Expressing, Transfection, Activity Assay

Journal: The Journal of Biological Chemistry

Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

doi: 10.1016/j.jbc.2025.110247

Figure Lengend Snippet: Effect of nsp10 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp10 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp10 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp10 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp10 mutants, and other mini-RTC components, and Fluc activity was measured at 36 hpt. Data are presented as mean ± SD, representing three independent experiments. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Techniques: Sequencing, Expressing, Transfection, Activity Assay

Journal: The Journal of Biological Chemistry

Article Title: Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus

doi: 10.1016/j.jbc.2025.110247

Figure Lengend Snippet: Effect of nsp12 characteristic mutations on sg-Rep-PRRSV transcription efficiency. A , sequence alignment of nsp12 from PRRSV GD and XM-2020 strains, highlighting amino acid differences. B , AlphaFold 2-predicted 3D structure of nsp12 with selected mutations highlighted in stick representation in PyMOL. C , sequencing results of nsp12 expression plasmids carrying single point mutations. D , BHK-21 cells were co-transfected with sg-Rep-PRRSV, nsp12 mutants, and other mini-RTC components, and Fluc activity was measured at 36 hpt. Data are mean ± SD from at least three biological replicates. ∗∗∗ p < 0.001; ∗∗ p < 0.01; ∗ p < 0.05; ns, not significant.

Techniques: Sequencing, Expressing, Transfection, Activity Assay

Review

Structured Review

Images

1) Product Images from "Key amino acids in RNA polymerase and helicase proteins regulate RNA synthesis efficiency in porcine reproductive and respiratory syndrome virus"

Similar Products

Image Search Results